Introduction

Bread wheat (Triticum aestivum) is one of the staple food crops and consumed by ≥ 30% of the world as a main nutrient source (IWGSC 2014). Common wheat is composed of three different genomes (A, B and D) which characterize its allohexapolyploid nature (Son et al. 2020). Wheat was first cultivated from 10,000 years ago during a time called the ‘Neolithic revolution’ (Avni et al. 2017). At this time, einkorn (2x, AA) and emmer (4X, AABB) wheats were cultivated, and they are believed to have originated from the south-eastern regions of Turkey (Nesbitt 1998; Petersen et al. 2006; Avni et al. 2017). Bread wheat arose about 9000 years ago, and it was originated by natural hybridization of emmer with Aegilops species (Aegilops tauschii and Ae. Squarosa) (IWGSC 2014). Wheat cultivation spread in Korea during 1^st and 2^nd century BC through China (Crawford 2011).

The semi-dwarfing gene (Rht), leading to the “Green revolution”, is known to have been transmitted from Asian wheat (Korean or Japanese wheat landraces) (Hedden 2003). The mutant allele of the dwarfing gene was associated with yield increases (by 24%) and disease resistance, thus, over the 70% of wheat cultivars grown world-wide may have this mutant allele (Casebow et al. 2016). The Rht gene was consists to Rht1 (or RhtB1) and Rht2 (or RhtD1) which are located on chromosome 4B and 4D, respectively. Dwarfing genes encode DELLA proteins that inhibit plant growth while gibberellic acid (GA) promotes plant growth (Shin et al. 2014; Son et al. 2020). Ellis et al. (2002) developed molecular markers to identify of Rht1 and Rht2. Using these markers, wheat can be selected with reduced stem length up to 15% (Gale and Youssefian 1985; Flintham et al. 1997).

Three hundred and nine wheat landraces (6X, AABBDD) have been collected in Korea, which are a useful gene pool for the national wheat breeding program. Especially, for common wheat, no clear ancestors are known for common wheat, making this gene pool more useful (Kihara 1944; McFadden and Sears 1946). In Korea, 40 wheat cultivars have been developed by crossing of various wheat lines containing Korean landraces and some cultivars from other countries (Son et al. 2020). Consequently, some of the important traits of the landraces may be very crucial to run a successful breeding program for wheat.

Microsatellites containing simple sequence repeat (SSR) and inter simple repeat (ISSR) markers can be easily assayed for polymorphism using polymerase chain reaction (PCR) (Ahmad et al. 2019). In particular, a microsatellite, compared to other molecular marker types, has the advantage and useful as a co-dominant marker in the early generation of genetic separation as a co-dominant marker (Temnykh et al. 2000; Jaiswal et al. 2017). Clear polymorphisms can be identified compared to a restriction fragment length polymorphism (RFLP) and random amplification of polymorphic DNA (RAPD). These markers made it can clearly explain diversity of wheat. Because of the potential for microsatellites as molecular markers, Roder et al. (1995) investigated microsatellites in bread wheat. Such microsatellite or ISSRs have been used for analyzing the relationship between the species of wheat as well as gene mapping, and they were used for marker development associated with specific traits (Varshney et al. 1998; Ahmad et al. 2019; Howell et al. 2020).

In this study, we analyzed the relationship among Korean wheat landraces using microsatellites to confirm their genetic association and morphological characteristics so that they can be used in future breeding program.

Materials and Methods

Plant materials and morphological evaluation

The materials for this study consisted of 171 accessions containing Chinese spring and 170 Korean wheat landraces collected from different areas of Korea. One hundred seventy landraces were provided by the National Agrobiodiversity Center in the National Academy of Agricultural Science of Rural Development Administration (Jeonju, Korea) and were selected from 309 landraces. The agricultural traits such as stem length and heading date were evaluated following Agricultural Science and Technology Survey Analysis Standard (RDA 2012).

DNA isolation and PCR amplification

The young leaves were detached from plant and frozen immediately into liquid nitrogen and then leaf samples were grinded into powder using a plastic grinder. Two hundred (200) mg of grinded samples was taken to extract genomic DNA using a plant genomic DNA prep kit (Biofact, Korea). The extracted genomic DNA was quantified using a Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, U.S.A.). For the PCR amplification, the Veriti® Dx 96-Well Thermal Cycler (Applied Biosystem, USA) was used. PCR amplification was done with 1 unit of Taq polymerase (i-star maxII, Korea), 100 ng genomic DNA, 1× PCR buffer, 0.5 μM primer, 200 μM and dNTPs in a total volume of 25 μL. PCR reactions were 35 cycles of 94°C for 30 s, 50-60°C for 30 s, and 72°C for 1 min. The PCR product was electrophoresed at 100V for 0.5–1 h with a 1.5% agarose gel and using a QIAxcel auto electrophoresis machine (Qiagen, U.S.A.).

The PCR reaction for the Rht gene was performed using the following oligonucleotide primers, as reported by Ellis et al. (2002): B1aF, GGTAGGGAGGCGAGAGGCGAG; B1aR, CATCCCCATGGCCATCTCGAGCTG; B1bF, GGTAGGGAGGCGAGAGGCGAG; B1bR, CATCCCCATGGCCATCTCGAGCTA; D1aF, GGCAAGCAAAAGCTTCGCG; D1aR, GGCCATCTCGAGCTGCAC; D1bF, CGCGCAATTATTGGCCAGAGATAG; D1bR, CCCCATGGCCATCTCGAGCTGCTA. The PCR reactions were as follows: 35 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min. The PCR reactions and gel product were obtained as described in above paragraph. Three of the landraces were not amplified in RhtB1 and RhtD1, so they were not included in the results of the Rht analysis.

Statistical and phylogenetic relationship analysis

The presence or absence of SSR and ISSR bands in the result of electrophoresis results were recorded as a binary code 1 or 0, which was used for the phylogenetic analysis of the accessions. Polymorphism information content was calculated using the formula PIC = 1- (Liu 1998). All analysis of the genetic diversity and phylogenetic relationship and principle component analysis (PCA) were performed using the R software (R-3.5.1). The R project for statistical computing, https://www.rproject.org). The dendrogram was built by using the unweighted pair-group method and "dist" function in R with the option of "binary", the genetic data were calculated the distance from each sample. And The "hclust" function was used to merge each sample distance with the option of Ward. That data was visualized by "plot" function and to make rount shape, "fan" option was used. The PCA analysis was performed by "prcomp" function in R. That function printed the eigen value and eigen vector from the SSR polymorphism data that converted the number (0, 1). The point colors were mapped to the distribution by the result of phylogenic tree group.

Results

Agricultural characteristics of Korean landrace wheat

Table 1: Summary of the agricultural characteristics of the Koran wheat landraces

	Heading date (mm.dd)	Stem length (cm)	Length of spike (cm)	Awn length (cm)	No. of grain per spike	No. of tiller	1000 grain weight (g)
Average	4.14	102.2	9.3	5.0	17.1	7.6	34.9
Standard error	± 4.6 day	± 1.53	± 0.09	± 0.14	± 0.13	± 0.24	± 0.57

Table 2: Primers used in the current study and their genetic diversity

	Forward sequence	Reverse sequence	Repeat motif (N)n	Type	PIC	No. of polymorphic bands	Ae	I	h
Xgwm356	CCAATCAGCCTGCAACAAC	AGCGTTCTTGGGAATTAGAGA		SSR	0.38	2	1.507	0.519	0.336
Gwm268	TTATGTGATTGCGTACGTACCC	AGGGGATATGTTGTCACTCCA		SSR	0.99	2	1	0	0
Gwm291	AATGGTATCTATTCCGACCCG	CATCCCTAGGCCACTCTGC		SSR	0.99	18	6.237	0.22	0.839
Gwm293	TCGCCATCACTCGTTCAAG	TACTGGTTCACATTGGTGCG		SSR	0	1(all)	1	0	0
Xgwm294	GCAGAGTGATCAATGCCAGA	GGATTGGAGTTAAGAGAGAACCG		SSR	0.99	8	3.987	1.598	0.749
Xgwm295	GTGAAGCAGACCCACAACAC	GACGCCTGCGACGTAGAG		SSR	0.99	2	3.027	1.27	0.669
Gwm325	TTTTTACGCGTCAACGACG	TTTCTTCTGTCGTTCTCTTCCC		SSR	0.99	1	1.046	0.11	0.044
Xwmc407	CATATTTCCAAATCCCCAACTC	GGTAATTCTAGGCTGACATATGCTC		SSR	0.99	5	1.348	0.551	0.258
Gwm484	AGTTCCGGTCATGGCTAGG	ACATCGCTCTTCACAAACCC		SSR	0.97	7	5.01	1.75	0.8
Wmc527	GCTACAGAAAACCGGAGCCTAT	ACCCAAGATTGGTGGCAGAA		SSR	0.99	3	2.933	1.234	0.659
Xcfa2129	ATCGCTCACTCACTATCGGG	GTTGCACGACCTACAAAGCA		SSR	0	1(all)	1	0	0
BE585744	GCTATGGCATTCCTCAGCTC	GCCCAAGCCATATCTATCCA		SSR	0.99	1	1	0	0
gwm133	ATCTAAACAAGACGGCGGTG	ATCTGTGACAACCGGTGAGA		SSR	0.98	4	3.064	1.419	0.673
gwm493	TTCCCATAACTAAAAACCGCG	GGAACATCATTTCTGGACTTTG		SSR	0.48	6	1.861	1.032	0.462
wmc156	GCCTCTAGGGAGAAAACTAACA	TCAAGATCATATCCTCCCCAAC		SSR	0.99	3	1.536	0.641	0.349
ISSR807	AGAGAGAGAGAGAGAGT		(AG)8T	ISSR	0.07	2	1.077	0.159	0.072
ISSR808	AGAGAGAGAGAGAGAGC		(AG)8G	ISSR	0.92	11	2.66	1.292	0.624
ISSR810	GAGAGAGAGAGAGAGAT		(GA)8T	ISSR	0.89	5	4.5	1.56	0.777
ISSR815	CTCTCTCTCTCTCTCTG		(CT)8G	ISSR	0.95	7	4.154	1.739	0.759
ISSR824	TCTCTCTCTCTCTCTCG		(TG)8G	ISSR	0.97	2	8.727	0.601	0.885
ISSR827	ACACACACACACACACG		(AC)8G	ISSR	0.99	9	1.664	0.834	0.399
ISSR835	AGAGAGAGAGAGAGAGYC		(AG)8YC	ISSR	0	3(all)	1	0	0
ISSR841	GAGAGAGAGAGAGAGAYC		(GA)8YC	ISSR	0	2(all)	1	0	0
ISSR842	GAGAGAGAGAGAGAGAYG		(GA)8YG	ISSR	0.99	8	4.28	1.601	0.766
ISSR848	CACACACACACACACARG		(CA)8RG	ISSR	0.98	12	1.304	0.395	0.233

PIC; polymorphism information content, Ae; Number of effective alleles, I; Shannon's information index, h; Nei's gene diversity

Stem length, heading date and 1000 grain weight (TGW) of the landraces were investigated according to the agricultural science and technology survey analysis standard (RDA 2012). Agronomic characteristics of these landraces varied widely for stem length (SL), number of grains per spike and TGW varied widely (Fig. 1). The stem length (SL) varied from 54 to 152 cm, and the average length was 102.2 cm. Wheat landraces with stem lengths less than 60 cm were identified as two strains, 60 cm to 69 cm as five, 70 cm to 90 cm as 48, and over 90 cm as 115. The average number of grains per spike varied from 12.2 to 22.7 (average 17.1). The average heading date was April 15, TGW was 18.9 g to 53.2 g, and the average was 34.9 g. The average lengths of the spike (LS) and awn length (AL) were 9.3 cm and 5.0 cm, respectively, and the average number of tiller (NT) was 7.6 (Table 1).

Result of the PCR amplification for SSR and ISSR markers

The 25 primers showed consistent amplification among the analyzed resources and 13 primers consisted of a 3’-end anchoring ISSR primer. Each primer set produced from 1 to 20 detectable amplified bands and their size ranged from 100 to 2000 bp. Although major bands were reproduced in the repeated reactions, some minor and faint bands were inconsistent, which were excluded from further analysis. Polymorphisms were observed among the different Korean landraces. The 12 SSR and 13 ISSR markers generated 2821 polymorphic bands available for phylogenetic analysis, corresponding to an average of 3.48 polymorphic bands per primer. The polymorphism information content (PIC) of the primers was over the 0.95 except for eight primers. Twenty-one markers detected variable polymorphisms in all the resources, but four markers, Gwm293, Xcfa2129, ISSR835 and ISSR841, were amplified equally in all resources. Three markers, Xgwm356, Gwm493 and ISSR807, showed had a low PIC of 0.38, 0.48 and 0.07, respectively (Table 2).

Genetic diversity analysis of the Korean wheat landraces

Spurious minor bands were excluded from this analysis to obtain a robust phylogenetic relationship among the 170 Korean landraces, and a total of 2821 polymorphic bands were used. The clustering pattern revealed that the resources were categorized into five major groups. Group I to V contained 30, 35, 25, 55 and 26 lines, respectively. Six wheat landraces, IT159752 (group I), IT159762 (group I), IT151032 (group II), IT151044 ((group II), IT151048 (group III) and IT151049 (group III) had the same genotypes. Chinese spring was used as an outgroup, but it also clustered with the Korean landraces (Fig. 2A).

The PCA of the profiles of the 170 landraces showed the distribution and to provide a board visual comparison. In addition, it was performed to compare the main components and agricultural characteristics among the wheat landraces. PC1 and PC2 accounted for the low of variance (6.55 and 5.74%, respectively). PC1 was closely related single kernel trait of wheat, and PC2 was related to both tillers per plant trait and 808 ISSR polymorphisms. Although most of the landraces showed differences, some of the landraces were grouped in the plot. Almost all of the landraces among group I, III and IV clustered. The landraces of group I are on the left-hand side and low on the PCA plot (i.e., PC1 and PC2 were negative), and the landraces of group III and IV are on the right-hand side of the PCA plot (i.e., PC1 was positive). This result was similar with the dendrogram (Fig. 2A, 2C).

Fig. 1: Distribution of the agricultural traits of the Korean wheat landraces. This graph indicates the numerical range of each trait. A; stem length, B; number of grain per spike, C; 1000 grain weight

Fig. 2: Analysis of the phylogenetic relationship and genetic diversity of the 170 collected Korean wheat landraces. A; Dendrogram, B; distribution of the collection regions of the Korean wheat landraces. Each spots represents each group, and size shows some number of the landraces, C; PCA analysis of the profiles obtained by the polymorphic bands of the SSRs and ISSRs, D; Distribution of stem length of Korean wheat landraces by each group

The stem length of the lines was various. The average stem length of Group I and V was 104.8 and 108.9 cm, respectively, which are taller than groups II, III and IV (Fig. 2D, Table 3). Additionally, 45 of the 56 resources among group I and V were collected in the regions near west coast and southeast coast of Korea. Nine excluded wheat resources belong to group V, which were collected in the same region near the southeastern inland of Korea. Most of the resources among groups II, III and IV are located in near the west and south coast, and the other resources were wheat collected from the near the west, south sea and central inland region of Korea (Fig. 2B).

Distribution of the Rht gene

The RhtB1a allele was amplified in 127 and the Rht-B1b allele in 31 of 170 landraces, respectively. Ten landraces have both the RhtB1a and RhtB1b alleles. The RhtD1a and RhtD1b alleles were identified in 129 and 38 landraces, respectively. It was identified that the RhtB1a allele was together with RhtD1b, and the RhtB1b allele was coupled with the RhtD1a, respectively. Ten landraces (RhtB1a/RhtB1b) were only coupled with RhtD1a allele. It is interesting that no landraces have both RhtB1b and RhtD1b.

The stem length of the 170 Korean wheat landraces was 102.2 cm. The stem length of the landraces containing the RhtB1a allele was 103.80 cm on average the RhtB1b allele averaged 91.70 cm; the RhtD1a allele averaged 105.80 cm, and the RhtD1b allele averaged 89.55 cm, respectively (Table 4). The stem length of 10 landraces was the longest with an average of 114.3 cm compared with the other genotypes. However, other agricultural traits, LS, AL, NT and TGW did not show any significant differences for allele composition of the Rht genes (Fig. 3). The mean number of effective alleles (Ae), Shannon’s information index (I) and Nei’s gene diversity of the RhtB1b and RhtD1b alleles of the Korean landraces showed high scores. These were 30.072 (Ae), 0.310 (h) and 0.966 (I) for RhtB1b and 20.013 (Ae), 0.334 (h) and 0.950 (I) for RhtD1b, respectively. The RhtD1a alleles had a lower Ae (1.710) and genetic diversity (0.205 for I and 0.415 for h values) compared with the other alleles (Table 4).

Table 3: Characteristics of each group in the analysis of the phylogenetic relationship

Groups	No. of lines	Average of stem length (cm)	Standard error
Group 1	30	104.8	± 3.87
Group 2	35	99.1	± 4.31
Group 3	25	99.8	± 5.30
Group 4	55	96.6	± 2.87
Group 5	26	108.9	± 3.40

Chines spring was group 1

Table 4: Summary of the genetic diversity of the Rht gene in the Korean wheat landraces

Allele	No. of lines	Type	Ne	I	h	Stem length (cm)
						Average ± SE
RhtB1a	127	wild	1.820	0.221	0.450	103.80±1.58
RhtB1b	31	dwarf	30.072	0.310	0.966	91.70±2.96
RhtD1a	129	wild	1.710	0.205	0.415	105.80±1.82
RhtD1b	38	dwarf	20.013	0.334	0.950	89.55±1.79

Ne; number of effective alleles, I; Shannon's information index, h; Nei's gene diversity, SE; Standard error. Non amplified three lines and 10 lines containing both RhtB1a and RhtB1b alleles equally were excepted in this data

Fig. 3: Agricultural characteristics of the landraces according to the composition of the Rht allele. RhtB1b allele data were same with the total. SL; stem length, LS; length of spike, AL; awn length, NGS; number of grains per spike, NT; number of tiller, TGW; 1000 grain weight

Discussion

Wheat is one of the most important but in Korean wheat is a supplementary crop. However, Korean wheat consumption has increased rapidly (Son et al. 2020). The collected wheat used in this study was allohexapolyploid (AABBDD) wheat and it is thought that the improved wheat from China has propagated in Korea indicating it was not originated from Korea, previous reports also suggest that the origin of wheat was from southeastern Turkey (Heun et al. 1997; Nesbitt 1998; Dubcovsky and Dvorak 2007). The Korean landraces were evenly collected over the whole Korea to present the geographic characteristics of whole Korea including the location of the carbonized seeds (Kim 2013). These landraces were genetically different except for a few traits. Genetic diversity in this set of landraces is advantageous for developing the new wheat varieties.

Microsatellite DNAs have been used in various plant to analyze genetic diversity or phylogenetic relationship (Ahmad et al. 2019; Chen et al. 2019; He et al. 2019). Molecular marker techniques are utilized in elite wheat breeding processes for DNA fingerprinting, marker assisted breeding (MAS), and quantitative trait loci (QTLs) analysis (Lee et al. 2012). In this study, we used SSRs and ISSRs equally in the analysis of the phylogenetic relationship of Korean traditional wheat. We used two kinds of marker datasets at the same time, because this method was thought to enable a complementary role in many polymorphic band identification and phylogenetic analysis. Phylogenetic analysis of wheat was also attempted using barcoding DNA containing nuclear and chloroplast DNA (Dizkirici et al. 2013). In addition, the nucleotide sequence of the wheat was decoded, and an evolutionary analysis was performed for a comparative phylogenetic analysis by analyzing the genetic material of each sub-genome A, B and D of wheat (Hadzhimateva et al. 2015). Phylogenetic analysis of wheat landraces was attempted in Kazakhstan. Landraces were analyzed using an SNP array and compared with local location (Turuspekov et al. 2015). The landraces used in this study were also found to be closely related to the geographical characteristics of Korea. Their genetic and phenotypic characteristics of the Korean wheat landraces were very diverse, and the collection areas of the wheat belonged to each group. PCA analysis is slightly similar to phylogenetic relationship and data analysis using the SSRs and ISSRs in combination can be trustworthy. It was expected that the genetic characteristics of wheat in the inland and coastal areas were far apart, and the genetic distance of wheat near the coast was close. This was presumably because of the geographical characteristics of Korea: the plains in the southwest, and the high zones and mountain ranges in the east.

Because Rht gene was expected to have been transmitted from Korean or Japanese wheat varieties, it is very important as the gene that could solve the world’s food shortage problem. Rht-1 dwarfing alleles are related to stem length and wheat productivity (Son et al. 2020). Although various alleles of the Rht-1 gene have been reported however, RhtB1b and RhtD1b alleles are mutants related to reducing the stem length and increase the lodging resistance and yield productivity (Casebow et al. 2016; Rasheed et al. 2016). It has been reported that the RhtB1a and RhtD1a alleles were related to longer stems (Ellis et al. 2002). Most of the Korean wheat landraces had the RhtB1a and RhtD1a alleles, and most of these lines had a longer stem length. The mutant alleles, RhtB1b and RhtD1b, were rarely seen (17–22%, respectively) in the landraces, and these alleles showed a high correlation with a short stem length. Our results supported by previous report that about 45% of wheat has the RhtB1b allele, and most wheat varieties have RhtD1a (Wurschum et al. 2017). However, 10 landraces were heterozygous and having both alleles RhtB1a and RhtB1b equally indicating the unique characteristic of Korean wheat landraces. It also differed from previous reports on the Rht-1 gene using modern wheat lines; thus, further research is necessary. The stem length of wheat with RhtB1b and RhtD1b at the same time was shorter than that of the wild type of Rht. We also indicate that RhtD1b is a recessive gene (Son et al. 2020), therefore, so we also speculated that this gene was transmitted from Asian wheat to the global wheat germplasm. However, further research into this gene is necessary to utilize in future breeding programs.

Conclusion

Korean wheat landraces showed high polymorphism and genetic diversity. Except for 6 lines, all 164 lines showed different genetic characteristics. Rht gene analysis revealed a specific distribution of alleles. Most of the landraces had the wild type gene; in contrast, both the RhtB1b and RhtD1b alleles were identified only in 31 and 38 landraces, respectively. Because the results of the Rht analysis differ from the existing theories, the relationship between the diversity of the Rht genes and phenotype needs to be studied further. In addition, many Korean wheat landraces containing genetic diversity analyzed in this study are expected to be useful for the development of Korean wheat varieties.

Acknowledgements

This work was carried out with the support of Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ013159032020), Rural Development Administration, Republic of Korea.

Author Contributions

Conceptualization, JHS, CK and C-SK; Methodology, J-HS, JC and JY; Software, CK, JC and CC; Validation. K-HK, K-MK and H-YJ; Investigation, J-HS and C-SK; Data curation, Y-MY, Y-JK and JP; Project administration, T-IP and C-SK; Writing-original draft preparation, J-HS; Writing-review and editing, CK and C-SK; Writing-discussion, J-HS, CK and C-SK; Funding acquisition, C-SK. All authors have read and agreed to the published version of the manuscript.

References

Ahmad, MQ, M Hassan, A Qayyum, MA Saleem, W Malik, E Noor, S Ul-Allah (2019). Characterization of synthetic wheat germplasm using morphological and molecular markers. Intl J Agric Biol 22:131‒138

Avni R, M Nave, O Barad, K Baruch, SO Twardziok, H Gundlach, I Hale, M Mascher, M Spannagl, K Wiebe, KW Jordan, G Golan, J Deek, B Ben-Zvi, G Ben-Zvi, A Himmelbach, RP MacLachlan, AG Sharpe, A Fritz, R Ben-David, H Budak, T Fahima, A Korol, JD Faris, A Hernandez, MA Mikel, AA Levy, B Steffenson, M Maccaferri, R Tuberosa, L Cattivelli, T Komatsuda, T Eilam, H Sela, A Sharon, N Ohad, DA Chamovitz, KFX Mayer, N Stein, G Ronen, Z Peleg, CJ Pozniak, ED Akunov, A Distelfeld (2017). Wild emmer genome architecture and diversity elucidate wheat evolution and domestication. Science 357:93‒97

Casebow R, C Hadley, R Uppal, M Addisu, S Loddo, A Kowalski, S Griffiths, M Gooding (2016). Reduced height (Rht) alleles affect wheat grain quality. PLoS One 11; Article e0156056

Chen M, X She, D Liu, Y Li, C Li (2019). Genetic diversity between and within Lilium species and hybrids revealed by ISSR. Intl J Agric Biol 21:1235‒1240

Crawford GW (2011). Advances in understanding early agriculture in Japan. Curr Anthropol 52:331‒345

Dizkirici AC, S Onde, M Birsin, M Ozgen, Z Kaya (2013). Phylogenetic relationships among Triticum L. and Aegilops L. species as genome progenitors of bread wheat based on sequence diversity in trnT-F region of chloroplast DNA. Genet Resour Evol 60:2227–2240

Dubcovsky J, J Dvorak (2007). Genome plasticity a key factor in the success of polyploidy wheat under domestication. Science 316:1862‒1866

Ellis MH, W Spielmeyer, KR Gale, GJ Rebetzke, RA Richards (2002). “Perfect” markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theor Appl Genet 105:1038‒1042

Flintham E, A Borner, A Worland, M Gale (1997). Optimizing wheat grain yield effects of Rht (gibberellin-insensitive) dwarfing genes. J Agric Sci 128:11‒25

Gale MD, S Youssefian (1985). Dwarfing genes in wheat. In: Progress in Plant Breeding, Vol. 1, pp:1‒35. Russed GE (Ed.). Butterworths, London

Hadzhimateva D, I Avdjieva, E Todorovska, D Vassilev (2015). A comparative phylogenetic analysis of hexaploid wheat evolution. J BioSci Biotechnol 2015:31–37

He Q, Y Li, Y Liu, Z Li, S Sun, Q Zhan (2019). Genetic diversity in the worldwide Alfalfa germplasm assessed through SSR markers. Intl J Agric Biol 22:1205‒1210

Hedden P (2003). The genes of the green revolution. Trends Genet 19:5‒9

Howell SE, MQ Ahmad, MA Saleem, A Qayyum, S Ul-Allah, E Noor, W Malik, S Mahmood, B Islam (2020). Population structure, genetic diversity and selection of terminal heat stress tolerant synthetic derivative wheat genotypes. Intl J Agric Biol 24:238‒246

Heun M, R Schafer-Pregl, D Klawan, R Castagna, M Accerbi, B Borghi, F Salamini (1997). Site of einkorn wheat domestication identified by DNA fingerprinting. Science 278:1312‒1314

IWGSC – International Wheat Genome Sequencing Consortium (2014). A chromosome-based draft sequence of the hexaploid bread wheat (Triticum Aestivum) genome. Science 345; Article 1251788

Jaiswal S, S Sheoran, V Arora, UB Angadi, MA Iquebal, N Raghav, B Aneja, D Kumar, R Singh, P Sharma, GP Singh, A Rai, R Tiwari, D Kumar (2017). Putative microsatellite DNA marker-based wheat genomic resource for varietal improvement and management. Front Plant Sci 8; Article 2009

Kihara H (1944). Discovery of the DD-analyser, one of the ancestors of Triticum vulgare. Agric Hortic 19:13‒14

Kim M (2013). Wheat in ancient Korea: A size comparison of carbonized kernels. J Acheaeol Sci 40:517‒525

Lee SI, KC Park, MW Ha, KS Kim, YS Jang, NS Kim (2012). CACTA transposon-derived Ti-SCARs for cultivar fingerprinting in rapeseed. Genes Genom 34:575‒579

Liu BH (1998). Statistical genomics: Linkage, Mapping and QTL Analysis. CRC Press, Boca Raton, Florida, USA

McFadden, ES, ER Sears (1946). The origin of Triticum spelta and its free threshing hexaploid relatives. J Hered 37:107‒116

Nesbitt M (1998). Where was einkorn wheat domesticated? Trends Plant Sci 3:1360‒1385

Petersen G, O Seberg, M Yde, K Berthelsen (2006). Phylogenetic relationships of Triticum and Aegilops and evidence for the origin of the A, B, and D genomes of common wheat (Triticum aestivum). Mol Phylogenet Evol 39:70‒82

Rasheed A, W Wen, F Gao, S Zhai, H Jin, J Liu (2016). Development and validation of KASP assays for functional genes underpinning key economic traits in wheat. Theor Appl Genet 129:1843‒1860

RDA – Rural Development Administration (2012). Standard of Research and Analysis for Agricultural Technology, pp:339‒365. Embrapa Labex, Korea

Roder MS, J Plaschke, SU Konig, A Borner, ME Sorells, SD Tanksley, MW Ganal (1995). Abundance, variability and chromosomal location of microsatellites in wheat. Mol Gen Genet 246:327‒333

Shin SH, KH Kim, JH Son, CS Kang, YK Cheong, CK Lee, JC Park, CS Park (2014). Analysis of Semi-dwarf gene (Rht) Construction and its relationship with agricultural characteristics, pre-harvest sprouting, and fusarium head blight in Korean wheat cultivar. J Agric Life Sci 43:72‒79

Son JH, CH Choi, JB Chun, KH Kim, KM Kim, YJ Kim, JH Park, JW Yang, CS Kim, CS Kang (2020). Evaluation of functional markers related to agronomic traits for selecting efficient marker sets in wheat. Intl J Agric Biol 23:340‒348

Temnykh S, WD Park, N Ayres, S Cartinhour, N Hauck, L Lipovich, YG Cho, T Ishii, SR McCouch (2000). Mapping and genome organization of microsatellite sequences in rice (Oryza sativa L.). Theor Appl Genet 100:697‒712

Turuspekov Y, J Plieske, M Ganal, E Akhunov, S Abugalieva (2015). Phylogenetic analysis of wheat cultivars in Kazakhstan based on the wheat 90 K single nucleotide polymorphism array. Plant Genet Resour 15:29‒35

Varshney RK, PC Sharma, PK Gupta, HS Balyan, B Ramesh, JK Roy, A Kumar, A Sen (1998). Low level of polymorphism detected by SSR probes in bread wheat. Plant Breed 117:182‒184

Wurschum T, ML Simon, CFH Longin, MR Tucker, WL Leiser (2017). A modern green revolution gene for reduced height in wheat. Plant J 92:892‒903